Ars Electronica Archive
www.aec.at
Info| Contact| Disclaimer
German English
PRIX PIC PRINT PRIXMAP
Starts Prize WIMA
Talks ans Lektures Art&Science

ARS ELECTRONICA ARCHIVE - STARTS Prize

Grand prize of the European Commission honoring innovation in Technology, Industry and Society stimulated by the Arts.
Appointed by the European Commission, Ars Electronica in collaboration with BOZAR and Waag Society has launched a prize to select the most pioneering collaborations and results in the field of creativity and innovation at the nexus of science and technology with the arts.

Starts Prize Grand Prize – Artistic Exploration 2017

I’m Humanity

Etsuko Yakushimaru
Original: IH_LiveAtYCAM1.jpg | 2000 * 1125px | 369.8 KB | “I’m Humanity” - Live performance at Yamaguchi Center for Arts and Media
Original: IH_LiveAtYCAM4.jpg | 2000 * 1125px | 425.2 KB | “I’m Humanity” - Live performance at Yamaguchi Center for Arts and Media
Original: IH_LiveAtYCAM6.jpg | 2000 * 1125px | 356.9 KB | “I’m Humanity” - Live performance at Yamaguchi Center for Arts and Media
Original: ImHumanity_CD2.jpg | 5713 * 3814px | 14.9 MB | “I’m Humanity” CD artwork (CD in the UV-printed petri dish)
Original: ImHumanity_CD3.jpg | 6016 * 4016px | 16.4 MB | “I’m Humanity” CD artwork (CD in the UV-printed petri dish)
Original: ImHumanity_culture1.jpg | 5472 * 3648px | 12.0 MB | I’m Humanity” genetically-modified microorganism
Original: ImHumanity_culture3.jpg | 5472 * 3648px | 12.5 MB | I’m Humanity” genetically-modified microorganism
Original: ImHumanity_Digital_Artwork.jpg | 1600 * 1600px | 1.3 MB | “I’m Humanity” digital music artwork
Original: ImHumanity_Ex2.JPG | 5472 * 3648px | 4.1 MB | Exhibition of “I’m Humanity” genetically-modified microorganism
Original: ImHumanity_YXMR2.JPG | 4000 * 2248px | 2.1 MB | Etsuko Yakushimaru with “I’m Humanity” genetically-modified microorganism
Original: ImHumanity_YXMR3.jpg | 4000 * 2248px | 5.6 MB | Etsuko Yakushimaru with “I’m Humanity” genetically-modified microorganism
Original: ImHumanity_YXMR4.JPG | 4000 * 2248px | 1.8 MB | Etsuko Yakushimaru with “I’m Humanity” genetically-modified microorganism
Original: ImHumanity_YXMR.jpg | 4000 * 2248px | 4.3 MB | Etsuko Yakushimaru with “I’m Humanity” genetically-modified microorganism
Original: iTunes_TOP_201609.png | 1920 * 1080px | 1.1 MB | “I’m Humanity” on the iTunes top page of September 2016
    • CATALOG TEXT
    • CREDITS
    • BIOGRAPHY
    The project l’m Humanity is based on the concept of “post-humanity music” and explores how new music will be transmitted, recorded, mutated, and diffused whether sung or played via word of mouth, as scores, through radio, records and CDs, or cloud computing. Music travels through space and time, undergoing mutations on its way. The close connection between music and media is like that between transmission and recording, and can be thought of as genes and DNA. As a musician, Yakushimaru has worked in a variety of genres from pop to experimental music and has created various types of artwork such as drawings, installations, pieces that make use of satellite and biometric data, a song-generating robot, original instruments, and more.
    In l’m Humanity, Yakushimaru makes pop music with the use of the nucleic acid sequence of Synechococcus, which is a type of cyanobacteria. The musical information is converted into a genetic code, which was used to create a long DNA sequence comprising three connected nucleic acid sequences. The DNA was artificially composited and incorporated into the chromosomes of the microorganism. This genetically-modified microorganism with music in its DNA is able to continuously self-replicate. So even if humanity as we know it becomes extinct, it will live on, waiting for the music within it to be decoded and played by the species that replaces humanity.
    When thinking about the lifespan of recording media, for example, CDs are said to last for decades and acid-free paper is said to last for centuries. In comparison, DNA’s lifespan as a recording media is 500 thousand years, physicochemically speaking. Because the lifespan of DNA is so long, it has great potential as a recording media.
    On the other hand, it is not rare for nucleic acid sequences to mutate, and naturally this leads to changes in the genetic information. In that respect, in the history of “diffusion of music,” in which “mutation” has also had an important role in addition to “transmission” of information, the uniqueness of the “mutation” of nucleic acid sequences was strikingly similar.
    In the lyrics of I’m Humanity, the microorganism I’m Humanity sings “Stop the evolution―don’t stop it.” Although mutation spurs evolution, it also means the changing of a species. Perhaps I’m Humanity is caught between its own evolution and its fear that its evolving could mean the loss of nucleic acid sequences with musical information, which would make it impossible for I’m Humanity to sing the song anymore.
    I’m Humanity became the first song in human history to be released in the three formats of “digital music distribution,” “CD,” and “genetically-modified microorganism.” This song, produced with the use of biotechnology, was distributed as pop music and also made it on the Apple Music start page.

    Biotechnical procedures
    In our DNA, which consists of four kinds of nucleotides (A, C, G and T), each amino acid is encoded into a distinct nucleotide triplet. The rules for translation are summarized in the codon table. A cipher to convert the music chords into genetic codes was created based on this codon table used in living cells. The main chord progression of I’m Humanity was converted into the following 276 nucleotides:
    I’m Humanity: 276bp; A 22; T 101; G 57; C; 96 (GC content = 55.4%)
    GGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCATGGTCTTCCC
    CATGGTCTTCCCCATGGTCTTCCCCATTCTTCTGGAGGATCTTCTGGAGGATCTTCTTTGGGTTCTTCT
    GGAGGCGGTCTTCCCCATGGTCTTCCCCATCTTCTTCTTCTTGGTGGTGGTGGTATTCTTCTTCTCGGT
    GGTCCCACTGGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCAT
    The genetic code was artificially synthesized by a DNA synthesizer and inserted in a vector, designated pSyn_1. The inserted DNA fragment encoded music chords was introduced to a genome of a host cell (a cyanobacterium, Synechococcus elongatus PCC 7942) by homologous recombination. The music chords in the Synechococcus genome can be infinitely reproduced along with cell division.
    l’m Humanity produced and directed by Etsuko Yakushimaru

    Lyrics: Tica Alpha (a.k.a Etsuko Yakushimaru)
    Music: Tica Alpha (a.k.a Etsuko Yakushimaru)
    Genetic Codes: Etsuko Yakushimaru
    Art Direction & Drawing & Design: Etsuko Yakushimaru
    (C) 2016 Yakushimaru Etsuko

    Musical arrangement: Etsuko Yakushimaru, Motoki Yamaguchi
    Vocal & Chorus & Programming & dimtakt: Etsuko Yakushimaru
    Drums & Programming: Motoki Yamaguchi
    Recording & Mixing Engineer: Yujiro Yonetsu
    Mastering Engineer: Shigeo Miyamoto
    Technical Support: Satoshi Hanada
    Photograph & Movie: MIRAI seisaku / Photograph(Compact Disc): Satomi Haraguchi
    Label: MIRAI records
    (P) MIRAI records
    Support & Thanks: KENPOKU ART 2016, METI Ministry of Economy, Trade and lndustry., National Institute of Technology and Evaluation (NITE), Satoshi Hanada, Tokyo Metropolitan University, FabCafe MTRL, Yamaguchi Center for Arts and Media [YCAM]
    *Apple Music is a trademark of Apple Inc., registered in the U.S. and other countries.
    Etsuko Yakushimaru (JP) is an artist, musician, producer, lyricist, composer, arranger, and vocalist. Broadly active, from pop music to experimental music and art. Consistently independent in her wide-ranging activities, which also include drawing, installation art, media art, poetry and other literature, and recitation. Producing numerous projects and artists, including her band, Soutaiseiriron. While appearing in the music charts with many hit songs, she has also created a project that involved the use of satellite, biological data and biotechnology, a song-generating robot powered by artificial intelligence and her own voice, an independently-developed VR system, and original electronic musical instruments. Major recent activities include exhibitions at Mari Art Museum, Toyota Municipal Museum of Art, KENPOKU ART 2016, and Yamaguchi Center for Arts and Media [YCAM]. Her Tensei Jingle and Flying Tentacles albums, both released in 2016, received praise from figures including Ryuichi Sakamoto, Jeff Mills, Fennesz, Penguin Cafe, Kiyoshi Kurosawa and Toh EnJoe.
    Links: http://yakushimaruetsuko.com/archives/2602
    https://youtu.be/92Dcp9Fbdac
    https://itunes.apple.com/jp/album/id1149713825?app=music%20%20%20%20
    https://itunes.apple.com/jp/album/id1149713825?app=itunes
    http://wired.jp/special/2016/dear-synechococcus/
    Ars Electronica Linz GmbH & Co KG Ars-Electronica-Straße 1 4040 Linz Austria
    Tel. 0043.732.7272.0 Fax. 0043.732.7272.2 Email: info@ars.electronica.art

    This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No 732019.

    All Rights Reserved, 2018
    Copyright